If you have been reading about LC-MS/MS and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2025-09-19. Numbers and descriptions here follow the published literature rather than marketing material.
Regulatory and sporting contexts treat SR9009 as a prohibited substance in many elite competitions. Its presence on banned lists reflects concerns about performance enhancement and unknown long-term safety. Analytical chemists have developed methods to detect the parent compound and its metabolites in urine and blood. Literature discussions distinguish between in vitro potency, animal pharmacology, and anecdotal human reports. The latter are difficult to verify because products sold online may lack purity or contain different compounds.
SR9009 is a synthetic small molecule studied as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. These receptors help regulate circadian rhythms, lipid metabolism, and inflammatory gene expression. In cell and animal experiments, SR9009 alters transcription of clock-controlled genes and metabolic pathways. The compound is not a hormone and does not resemble classical steroid structures. Its activity depends on binding to the ligand-binding domain of REV-ERB, where it can modify corepressor recruitment.
Storage conditions for research-grade SR9009 generally involve a freezer at approximately minus twenty degrees Celsius, sometimes lower for long-term preservation. Containers should remain tightly closed and protected from light. Desiccants may be used to limit moisture uptake. Solutions are often stored in aliquots to avoid repeated warming and cooling. Stability data for the compound under various conditions are limited, so laboratories typically follow supplier recommendations and verify performance through periodic analytical checks rather than assuming indefinite stability.
Identity and purity testing for SR9009 commonly uses liquid chromatography coupled with tandem mass spectrometry. This method separates the compound from matrix components and detects it by mass-to-charge transitions, providing sensitive and specific confirmation. Nuclear magnetic resonance spectroscopy can support structural identification, while high-performance liquid chromatography with ultraviolet detection may estimate purity. Because online products labeled as SR9009 may contain other substances or no active compound at all, independent verification is important in research settings. Certificates of analysis are useful but not a substitute for in-house testing.
Laboratory samples of SR9009 are typically supplied as a white to off-white powder. The compound dissolves readily in organic solvents such as dimethyl sulfoxide and ethanol, while its solubility in water is low. Because of this solubility profile, researchers often prepare concentrated stock solutions in an organic solvent before diluting them into aqueous assay buffers. Light exposure, moisture, and repeated freeze-thaw cycles can degrade many small molecules, so handling procedures usually aim to minimize these factors. Purity is commonly checked before use.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic REV-ERB agonist | Binds REV-ERBα and REV-ERBβ in preclinical models |
| Molecular formula | C20H24ClN3O4S | Reported for the parent compound |
| CAS Registry Number | 1379686-30-2 | Common identifier in chemical databases |
| Appearance | Off-white to pale yellow solid | Typical research chemical solid |
| Solubility | Soluble in DMSO and ethanol; low in water | Class: small organic molecule |
SR9009 is not approved as a medicine by major regulatory agencies. It is commonly sold as a research chemical, a category that may fall outside customary drug approval and quality rules. In sports, the World Anti-Doping Agency lists SR9009 as a prohibited substance. Athletes who use it can face sanctions if it is detected in a sample. Legal status varies by country, and importation may be restricted. Enforcement practices differ across borders.
Detection of SR9009 in biological samples usually employs liquid chromatography coupled with tandem mass spectrometry. This method can identify the parent compound and sometimes metabolites in urine or blood. Because exposure can be low and clearance may be rapid, sample timing and limits of detection matter. Laboratories validate assays for sensitivity and specificity. Results are interpreted alongside chain-of-custody and quality-control records. Urine is the common matrix for anti-doping analysis, while blood may be used in research settings.
REV-ERB proteins typically suppress gene expression by recruiting corepressor complexes to DNA response elements. SR9009 binds these receptors and strengthens that repressive action in cell-based assays. Studies in rodents have reported changes in lipid handling, mitochondrial function, and exercise capacity after treatment. Such findings are often cited as evidence for metabolic effects, but species differences and limited pharmacokinetic data make direct translation to humans uncertain. Researchers continue to examine which effects are robust and which depend on specific experimental conditions.
SR9009 is frequently discussed alongside other REV-ERB ligands, including synthetic agonists and natural heme-related molecules. Its selectivity for REV-ERB over related nuclear receptors has been measured in binding and reporter assays, though off-target activity at higher concentrations is possible. The compound is prohibited in sport by the World Anti-Doping Agency, and it is not approved for any medical use in major jurisdictions. Products sold online may be labeled as research chemicals, and their identity and purity are not guaranteed by regulatory review.
SR9009 is a synthetic small molecule that acts on the nuclear receptors REV-ERBα and REV-ERBβ. These receptors are part of the circadian clock machinery and normally repress transcription of certain target genes. In laboratory research, SR9009 is used as a chemical tool to study how REV-ERB activity influences metabolism, inflammation, and daily biological rhythms. The compound is not an approved medicine, and its effects in humans remain largely uncharacterized. It is often described as an investigational agent rather than a therapeutic product.
SR9009 is a synthetic small molecule studied as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. These receptors help regulate circadian rhythms and metabolic gene expression. In laboratory experiments, SR9009 binds these receptors and alters transcription of genes involved in lipid handling, glucose metabolism, and mitochondrial function. It is not a naturally occurring compound and has no approved therapeutic use. Research interest stems from its ability to modify energy metabolism in cells and animal models.
In rodent studies, SR9009 has been reported to increase mitochondrial content in skeletal muscle and improve exercise endurance under some conditions. These findings led to popular descriptions such as an exercise mimetic, although that term oversimplifies the biology. Effects vary by dose, timing, tissue, and model. The compound's influence on circadian pathways means that time of administration can matter in experiments. Whether similar metabolic changes occur in humans remains largely unexplored in controlled published trials.
Pharmacokinetic data for SR9009 are limited in published literature. Some reports indicate low oral bioavailability and rapid clearance in animals, which complicates interpretation of exposure and effect. Researchers often use injected routes in preclinical work to achieve measurable systemic levels. Analytical studies rely on mass spectrometry to detect the parent compound and its metabolites. Questions about tissue distribution, active metabolites, and long-term consequences remain open. Species differences in metabolism can affect observed half-life and target engagement.
== History == Flucloxacillin was developed in the 1960s, following an increase in penicillin-resistant (beta-lactamase producing) staphylococcal infections, due to the widespread use of benzylpenicillin by 1960. All the natural penicillins and first semi-synthetic penicillins were destroyed by staphylococcal beta-lactamase, leading Beecham (later GlaxoSmithKline) to search for more stable antibiotics. By 1962, a series of similarly structured acid-stable penicillins (oxacillin, cloxacillin, dicloxacillin and flucloxacillin), with the potential for being taken by mouth, were developed. Flucloxacillin and dicloxacillin showed particular stability against the beta-lactamase enzyme of Staph. aureus and could withstand acid. Beecham further developed cloxacillin and popularised flucloxacillin in the UK, while Bristol Laboratories concentrated on marketing oxacillin and dicloxacillin in the United States, leading to the difference in use in each country. Flucloxacillin was first marketed in Europe in the 1970s.
Sir Joseph John Thomson (18 December 1856 – 30 August 1940) was a British physicist. He received the 1906 Nobel Prize in Physics "in recognition of the great merits of his theoretical and experimental investigations on the conduction of electricity by gases." In 1897, he showed that cathode rays were composed of previously unknown negatively charged particles (now called electrons), which he calculated must have bodies much smaller than atoms and a very large charge-to-mass ratio. The electron was the first subatomic particle to be discovered. Thomson is credited with finding the first evidence for isotopes of a stable (non-radioactive) element in 1912, as part of his exploration into the composition of canal rays (positive ions). His experiments to determine the nature of positively charged particles, with Francis William Aston, were the first use of mass spectrometry and led to the development of the mass spectrograph. Thomson was an influential teacher, and seven of his students went on to win Nobel Prizes: Ernest Rutherford (Chemistry 1908), Lawrence Bragg (Physics 1915), Charles Barkla (Physics 1917), Francis Aston (Chemistry 1922), Charles Thomson Rees Wilson (Physics 1927), Owen Richardson (Physics 1928) and Edward Appleton (Physics 1947). His son, George Paget Thomson, shared the 1937 Nobel Prize in Physics with Clinton Davisson "for their experimental discovery of the diffraction of electrons by crystals".
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
=== Baháʼí Faith === While there are no dietary restrictions in the Baháʼí Faith, `Abdu'l-Bahá, the son of the religion's founder, noted that a vegetarian diet consisting of fruits and grains was desirable, except for people with a weak constitution or those that are sick. He stated that there are no requirements that Baháʼís become vegetarian, but that a future society should gradually become vegetarian. `Abdu'l-Bahá also stated that killing animals was contrary to compassion. While Shoghi Effendi, the head of the Bahá'í Faith in the first half of the 20th century, stated that a purely vegetarian diet would be preferable since it avoided killing animals, both he and the Universal House of Justice, the governing body of the Baháʼís have stated that these teachings do not constitute a Baháʼí practice and that Baháʼís can choose to eat whatever they wish but should be respectful of others' beliefs.
Sources: en.wikipedia.org
The most common response was the possibility of a Metabolic Myopathy that translates to a metabolic muscle illness and are usually caused by the muscle's inability to breakdown nutrients. The muscles begin to break themselves down to yield energy. As Angel gets closer to possibly having a diagnosis, she starts to think about a possible future with children. She worries that if her disease is genetic, she wouldn't want to put her children at risk. A medical student from Italy reaches out to Dr. Sanders. She describes her 4th- year thesis on metabolic gene testing that could be beneficial in narrowing down a diagnosis. Angel travels to Turin, Italy for blood and urine testing. The testing showed that Angel had a normal metabolic gene profile, which eliminated many possible metabolic disorders. The physicians in Italy submitted her genomes into a sequencing trial that could take up to two months to process but could hopefully result with a diagnosis. After the two months, Angel receives a call from the Physician with a complete result and a solid diagnosis of Carnitine Palmitoyltransferase II Deficiency.
== Foreign policy == Ireland joined the League of Nations on 10 September 1923. It would also participate in the Olympics sending its first team to the 1924 Summer Olympics held in Paris. They would send further teams to the 1928 Summer Olympics and the 1932 Summer Olympics.
==== Carbon-nitrogen ==== Monoamine oxidase (MAO) is an extensively studied flavoenzyme due to its biological importance with the catabolism of norepinephrine, serotonin and dopamine. MAO oxidizes primary, secondary and tertiary amines, which nonenzymatically hydrolyze from the imine to aldehyde or ketone. Even though this class of enzyme has been extensively studied, its mechanism of action is still being debated. Two mechanisms have been proposed: a radical mechanism and a nucleophilic mechanism. The radical mechanism is less generally accepted because no spectral or electron paramagnetic resonance evidence exists for the presence of a radical intermediate. The nucleophilic mechanism is more favored because it is supported by site-directed mutagenesis studies which mutated two tyrosine residues that were expected to increase the nucleophilicity of the substrates.
Sources: en.wikipedia.org
SR9009 is a synthetic small molecule studied as an agonist of the REV-ERB nuclear receptors. It is not an approved medicine, and its effects in humans are not well characterized.
No. It is a synthetic ligand that binds nuclear receptors, not a steroid or peptide hormone. Its activity depends on receptor binding rather than endocrine secretion.
Clinical evidence is limited. Most published data come from cell and animal experiments. Human safety and efficacy remain uncertain.
Research-grade SR9009 is typically stored frozen at about minus twenty degrees Celsius, protected from light and moisture. Stock solutions are often kept in aliquots to avoid repeated freeze-thaw cycles. Specific storage conditions should follow the supplier's documentation.