This is a working overview of mitochondrial biogenesis, written for readers who want more than a one-paragraph summary but less than a textbook.
Reviewed 2026-03-28. Anything still debated is marked as such rather than presented as settled.
Analytical chemists detect SR9009 with liquid chromatography-tandem mass spectrometry, commonly abbreviated LC-MS/MS. Sample preparation may involve protein precipitation, liquid-liquid extraction, or solid-phase extraction before analysis. Laboratories can target the parent compound or its metabolites, depending on the matrix and the purpose of testing. Anti-doping methods require sensitive and specific assays because concentrations in biological samples can be low. Reference standards and validated methods are essential for reliable identification and quantification.
Regulatory agencies have not approved SR9009 for human therapeutic use. It is typically sold as a research chemical with labels stating that it is not for human consumption. The World Anti-Doping Agency prohibits the substance in sport, generally under the category of non-approved substances. Customs and national laws may restrict importation, sale, or possession. Product quality and legal status can vary by country and vendor, and therapeutic claims are not permitted in regulated advertising because the compound lacks approval.
Several misconceptions surround SR9009. It is often described as a SARM, a steroid, or an exercise pill, but its known target is the REV-ERB receptor family. Rodent studies have examined exercise capacity and metabolic markers, yet human outcomes remain unproven. Oral bioavailability appears low in animals, and human pharmacokinetics are not well characterized. Online products may contain impurities or different compounds, so identity and purity testing are important for research use.
In rodent studies, SR9009 has been reported to increase mitochondrial content in skeletal muscle and improve exercise endurance under some conditions. These findings led to popular descriptions such as an exercise mimetic, although that term oversimplifies the biology. Effects vary by dose, timing, tissue, and model. The compound's influence on circadian pathways means that time of administration can matter in experiments. Whether similar metabolic changes occur in humans remains largely unexplored in controlled published trials.
Pharmacokinetic data for SR9009 are limited in published literature. Some reports indicate low oral bioavailability and rapid clearance in animals, which complicates interpretation of exposure and effect. Researchers often use injected routes in preclinical work to achieve measurable systemic levels. Analytical studies rely on mass spectrometry to detect the parent compound and its metabolites. Questions about tissue distribution, active metabolites, and long-term consequences remain open. Species differences in metabolism can affect observed half-life and target engagement.
SR9009 is a synthetic small molecule studied as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. These receptors help regulate circadian rhythms and metabolic gene expression. In laboratory experiments, SR9009 binds these receptors and alters transcription of genes involved in lipid handling, glucose metabolism, and mitochondrial function. It is not a naturally occurring compound and has no approved therapeutic use. Research interest stems from its ability to modify energy metabolism in cells and animal models.
| Property | Value | Notes |
|---|---|---|
| Regulatory status | Not approved for human use | Research-use-only status in many markets |
| WADA status | Prohibited in sport | Generally listed as a non-approved substance |
| Detection technique | LC-MS/MS | Common for urine and blood analysis |
| Common alias | Stenabolic | Informal market nickname, not a pharmacopoeial name |
| Purity check | HPLC or LC-UV | Independent certificate of analysis is typical |
SR9009 is not approved as a medicine by major regulatory agencies. It is commonly sold as a research chemical, a category that may fall outside customary drug approval and quality rules. In sports, the World Anti-Doping Agency lists SR9009 as a prohibited substance. Athletes who use it can face sanctions if it is detected in a sample. Legal status varies by country, and importation may be restricted. Enforcement practices differ across borders.
Detection of SR9009 in biological samples usually employs liquid chromatography coupled with tandem mass spectrometry. This method can identify the parent compound and sometimes metabolites in urine or blood. Because exposure can be low and clearance may be rapid, sample timing and limits of detection matter. Laboratories validate assays for sensitivity and specificity. Results are interpreted alongside chain-of-custody and quality-control records. Urine is the common matrix for anti-doping analysis, while blood may be used in research settings.
Handling recommendations for SR9009 in a laboratory setting include storing the solid at low temperature, protected from light and moisture. The compound is often dissolved in dimethyl sulfoxide or ethanol for experiments. Solutions should be prepared with appropriate personal protective equipment and disposed of according to local rules. Stability data for long-term storage are limited, so stock solutions are typically kept cold and used within defined periods. Records of preparation date and concentration support reproducibility.
Research interest in SR9009 grew from studies of circadian biology and metabolic disease. Preclinical reports describe effects on exercise capacity, muscle metabolism, and blood lipid levels in rodents, but these findings come from controlled laboratory settings. The compound has low oral bioavailability in animals, which limits systemic exposure after swallowing. Investigators often use injected routes in experiments to achieve measurable plasma concentrations. Human clinical data are sparse, no approved therapeutic product exists, and whether animal effects translate to humans remains an open question.
Regulatory and sporting contexts treat SR9009 as a prohibited substance in many elite competitions. Its presence on banned lists reflects concerns about performance enhancement and unknown long-term safety. Analytical chemists have developed methods to detect the parent compound and its metabolites in urine and blood. Literature discussions distinguish between in vitro potency, animal pharmacology, and anecdotal human reports. The latter are difficult to verify because products sold online may lack purity or contain different compounds.
SR9009 is a synthetic small molecule studied as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. These receptors help regulate circadian rhythms, lipid metabolism, and inflammatory gene expression. In cell and animal experiments, SR9009 alters transcription of clock-controlled genes and metabolic pathways. The compound is not a hormone and does not resemble classical steroid structures. Its activity depends on binding to the ligand-binding domain of REV-ERB, where it can modify corepressor recruitment.
== Detector == Often the detector is a simple Faraday plate coupled to a transimpedance amplifier, however, more advanced ion mobility instruments are coupled with mass spectrometers in order to obtain both size and mass information simultaneously. It is noteworthy that the detector influences the optimum operating conditions for the ion mobility experiment.
The Constitution of Canada is the supreme law of the country and consists of written text and unwritten conventions. The Constitution Act, 1867 (known as the British North America Act, 1867 prior to 1982), affirmed governance based on parliamentary precedent and divided powers between the federal and provincial governments. The Statute of Westminster, 1931, granted full autonomy, and the Constitution Act, 1982, ended all legislative ties to Britain, as well as adding a constitutional amending formula and the Canadian Charter of Rights and Freedoms. The Charter guarantees basic rights and freedoms that usually cannot be overridden by any government; a notwithstanding clause allows Parliament and the provincial legislatures to override certain sections of the Charter for a period of five years.
=== Agonists === α-MSH - nonselective peptide full agonist β-MSH - nonselective peptide full agonist γ-MSH - nonselective peptide full agonist ACTH - nonselective peptide full agonist Afamelanotide - nonselective peptide full agonist BMS-470,539 - selective small-molecule full agonist Bremelanotide - nonselective peptide full agonist Melanotan II - nonselective peptide full agonist Modimelanotide - nonselective peptide full agonist Setmelanotide - nonselective peptide full agonist
=== Effects === A spasm may lead to muscle strains or tears in tendons and ligaments if the force of the spasm exceeds the tensile strength of the underlying connective tissue. This can occur with a particularly strong spasm or with weakened connective tissue.
Sources: en.wikipedia.org
Infants of mothers with inverted nipples can still achieve a good latch with perhaps a little extra effort. For some women, the nipple may easily become erect when stimulated. Other women may require modified breastfeeding techniques, and some may need extra devices, such as nipple shells, modified syringes, or breast pumps to expose the nipple. La Leche League and Toronto Public Health offer several techniques to use during pregnancy or even in the early days following birth that may help to bring a flat or inverted nipple out.
Other medications used include glucocorticoids (Deflazacort, Vamorolone); calcium channel blockers (Diltiazem); to slow skeletal and cardiac muscle degeneration, anticonvulsants to control seizures and some muscle activity, and Histone deacetylase inhibitors (Givinostat) to delay damage to dying muscle cells. Various figures of the occurrence of Duchenne muscular dystrophy are reported. One source reports that it affects about one in 3,500 to 6,000 males at birth in the U.S., (or 17 to 29 per 100,000 U.S. male births). Another source reports Duchenne muscular dystrophy being a rare disease and having an occurrence of 7.1 per 100,000 male births globally. A number of sources referenced in this article indicate an occurrence of 6 per 100,000. Duchenne muscular dystrophy is the most common type of muscular dystrophy, with a median life expectancy of 27–31 years. However, with comprehensive care, some individuals may live into their 30s or 40s. Duchenne muscular dystrophy is considerably rarer in females, occurring in approximately one in 50,000,000 live female births.
=== Relating force (F) to retention time (tr) === The relationship between the separative force field and retention time can be derived from first principles. Consider two particle populations within the FFF channel. The cross field drives both particle clouds towards the bottom "accumulation" wall. Opposing this force field is the particles' natural diffusion, or Brownian motion, which produces a counter acting motion. When these two transport processes reach equilibrium the particle concentration c approaches the exponential function of elevation x above the accumulation wall as illustrated in equation (1).
Sources: en.wikipedia.org
If a company transforms from a member state corporation to incorporate under the European Company Regulation 2001, employees are entitled to no less favourable representation than under the member state's existing board participation laws. This is practically important as a majority of EU member states require employee representation on company boards. Fourth, minimum job security rights are provided by three Directives. The Collective Redundancies Directive 1998 specifies that minimum periods of notice and consultation occur if more than a set number of jobs in a workplace are at risk. The Transfers of Undertakings Directive 2001 require that staff retain all contractual rights, unless there is an independent economic, technical or organisational reason, if their workplace is sold from one company to another. Last, the Insolvency Protection Directive 2008 requires that employees' wage claims are protected in case their employer falls insolvent. This last Directive gave rise to Francovich v Italy, where the Court of Justice affirmed that member states which fail to implement the minimum standards in EU Directives are liable to pay compensation to employees who should have rights under them.
== Clinical features == The disease caused by infection with this parasite is known as rangeliosis. In Brazil it is also known as nambi-uvú (bleeding ears), peste de sangue (bleeding plague) and febre amarela dos cães (yellow fever of dogs).
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
In the late 1990s, the World Trade Organization authorized the United States and Canada to impose retaliatory tariffs of US$116.8 million per year on the European Union after it found the EU beef hormone ban to be in violation of the WTO Agreement on the Application of Sanitary and Phytosanitary Measures (SPS Agreement). In September 2009, the trade representatives from the US and EU signed a memorandum of understanding, which established a new duty-free import quota in the European Union for grain-fed, high-quality beef as part of a compromise solution.
Sources: en.wikipedia.org
Legality depends on the country and the intended use. In many places it is not approved as a medicine and may be sold only as a research chemical. Importation or possession can be restricted, and sports organizations prohibit it.
Anti-doping laboratories typically use LC-MS/MS to detect SR9009 or its metabolites in urine or blood. The exact assay depends on the laboratory and the testing program. Detection can be challenging because the compound may be rapidly metabolized and present at low levels.
Stenabolic is an informal nickname used in online fitness and research-chemical markets, not an official drug name. It likely references reported effects on endurance in rodent studies. The nickname does not imply approval or proven human benefit.
It is a synthetic research compound that activates REV-ERB nuclear receptors. It is not an approved drug or dietary supplement. Most information comes from cell and animal studies.